Elaphe Guttata Guttata or Pantherophis guttatus?

[sapphire_moon]

I just seen in my copy of Reptiles that Elaphe Guttata is now Pantherophis guttatus?!

Do/can you use the old latin name or do you have to use the new one?

[Tim_Cranwill]

There is a $30 fine if you are caught using the old name after June 30th at 11:59pm. :p lol

Some new names take a while to catch on... :)

[marisa]

LOL.

The change took place a couple years ago if I remember correctly...in like 2001? I think....anyways most people still use "Elaphe Gutatta"

Like Morelia Viridis. THe Green Tree Python was formally known as Chondropython viridis and many people still call them "Chondros" and you know what people are talking about when either name is used.

Marisa

[LISA127]

Originally posted by Tim_Cranwill
There is a $30 fine if you are caught using the old name after June 30th at 11:59pm. :p lol

Some new names take a while to catch on... :)


LOL

[BoidKeeper]

See this is why I like common names best, they don't change. I hardly ever bother learning the latin names.
Cheers,
Trevor

[ReneeB]

Cornsnake.. :)

[VooDooMafia]

Yes I am sure if you talk to some of the herpers that have been around for along time (Roy Stockwell, Shaun Waite, Steve Marks and many others) they can prolly tell you how much things have changed over the years and I am sure they will change even more for teh years to come.

[Beardonicus]

Cornsnake.....red chicken snake....Rosy Ratsnake.....there are plenty of colorful common names, but as far as I know the latin name is Pantheropis guttatus.

[MouseKilla]

Originally posted by BoidKeeper
See this is why I like common names best, they don't change. I hardly ever bother learning the latin names.
Cheers,
Trevor

I think common names suck, too many different names for the same animal.

The other problem is that the names are just chosen arbitrarily and don't tell you a hell of a lot about what the animal in question. This becomes especially annoying when dealing with morphs.

Maybe names like "super pastel ghost BP" mean something if you know the genetic construction of the animal but otherwise it's just a bunch of nonsense. Even "snow corn" fails to be descriptive.

I figure it's reasonable to use common or trade names for dealing with a general group of animals, like Corn instead of whatever it is we're using for a latin name these days, but when it comes to the morphs it would be nice to know what goes into making them.

I say, if it's amelanistic or hypo or anery or whatever then say so, but then again that would take the fun out of being in the elite minority that understands what defines certain morphs.

[Cruciform]

Sure common names aren't very useful. But now they're finding out latin ones are fairly inaccurate too. It's all in the DNA.

In the future we'll be trading ATGTCAGTCCAGCTAA's and GTCCATCCAAGCTGAT's and no one will need to question the animal's heritage :S

[DragnDrop]

Or as they say in DNA-ville.....

CCTCTTGCGGCGATGCGTATGCTCGGCGTAGGAATGCTATCAATGCGTGG ATCAATGGGCGTTGAGCTTGTAATGGGACGTGCTCTTATGGATGTCATGG TCGTTGATGCGGCGATGCGTATGCTCGGCGTAGGAGTCGGACGTGCCCTT

To decode this strand of DNA, go to http://www.thinkbiotech.com/DNA-o-gram/

[Siretsap]

Common names are ok. I like the common names. It is true there are many common names for each snake and none are better than the others. That is the beauty of common names, depending from where you are, you won't call the snake the same.

[MouseKilla]

Siretsap,

What you're calling "the beauty" of common names I call a giant pain in the cloaca, so to speak. lol!

Cruciform,

You're quite right, that would be the most accurate way but the scientific names are based on a more or less predictable system, instead of being some frilly marketing ploy.